LAST finds similar regions between sequences, and aligns them.
For our first example, we wish to find and align similar regions between the human and fugu mitochondrial genomes. You can find these sequences in the examples directory: humanMito.fa and fuguMito.fa. We can compare them like this:
lastdb -cR01 humdb humanMito.fa lastal humdb fuguMito.fa > myalns.maf
The lastdb command creates several files whose names begin with "humdb". The lastal command then compares fuguMito.fa to the humdb files, and writes the alignments to a file called "myalns.maf".
The "-cR01" option suppresses alignments caused by simple sequence such as cacacacacacacacacacacaca.
The output has very long lines, so you need to view it without line-wrapping. For example, with a Unix/Linux/MacOsX command line, you can use:
less -S myalns.maf
Each alignment looks like this:
a score=27 EG2=4.7e+04 E=2.6e-05 s humanMito 2170 145 + 16571 AGTAGGCCTAAAAGCAGCCACCAATTAAGAAAGCGTT... s fuguMito 1648 142 + 16447 AGTAGGCTTAGAAGCAGCCACCA--CAAGAAAGCGTT...
The score is a measure of how strong the similarity is. EG2 and E are explained at last-evalues.html. Lines starting with "s" contain: the sequence name, the start coordinate of the alignment, the number of bases spanned by the alignment, the strand, the sequence length, and the aligned bases.
The start coordinates are zero-based. This means that, if the alignment begins right at the start of a sequence, the coordinate is 0. If the strand is "-", the start coordinate is in the reverse strand.
This alignment format is called MAF (multiple alignment format). You can convert it to several other formats using maf-convert (see maf-convert.html).
Use the lastdb -p option to indicate that the sequences are proteins:
lastdb -p -cR01 invdb invertebrate.fa lastal invdb vertebrate.fa
Here we use the -F15 option, to specify translated alignment with a score penalty of 15 for frameshifts:
lastdb -p -cR01 protdb proteins.fa lastal -F15 protdb dnas.fa
Suppose we have DNA reads in a file called reads.fastq, in fastq-sanger format. We can align them to the human genome like this:
lastdb -m1111110 humandb human/chr*.fa lastal -Q1 -e120 humandb reads.fastq | last-split > myalns.maf
This will use about 15 gigabytes of memory.
If you have paired reads, there are two options:
Unfortunately, there is more than one fastq format (see http://nar.oxfordjournals.org/content/38/6/1767.long). Recently (2013) fastq-sanger seems to be dominant, but if you have another variant you need to change the -Q option (see lastal.txt).
The default DNA scoring scheme used by lastal is tuned for finding long, weak alignments. It is:
match score = 1, mismatch cost = 1, gap cost = 7 + 1 * (gap length)
However, if you use option -Q1, it uses a different scoring scheme tuned for finding short, strong alignments:
match score = 6, mismatch cost = 18, gap cost = 21 + 9 * (gap length)
In the next two examples, we set the scoring scheme by hand.
Suppose we have DNA reads in fasta format (without quality data) instead of fastq. We need to omit the -Q option, but we wish to use the same scoring scheme as -Q1:
lastdb -m1111110 humandb human/chr*.fa lastal -r6 -q18 -a21 -b9 -e120 humandb reads.fa | last-split > myalns.maf
In this case we need to use the -Q option, but we wish to find weak alignments:
lastdb -cR01 humandb human/chr*.fa lastal -Q1 -r5 -q5 -a35 -b5 humandb reads.fastq > myalns.maf
This example uses a scaled version of the default alignment scores (1:1:7:1 -> 5:5:35:5). The reason for this is to put them on roughly the same scale as the fastq quality scores.
lastal uses the quality scores to modify the alignment scores, and then rounds the modified scores to integers. By using scaled alignment scores, we reduce the information loss caused by rounding.
WARNING! The standard score parameters do not align very short reads. This is because the match score is 6 and the score threshold is 120, so at least 20 high-quality matches are required (or a greater number of low-quality matches). In addition, last-split discards low-confidence alignments. To align very short reads, reduce lastal's score threshold (-e) or increase last-split's error threshold (-m).
If the score threshold is too low, you will get meaningless, random alignments.
You can make LAST more sensitive, at the expense of speed, by increasing lastal's m parameter. The default value is 10. So -m100 makes it more slow and sensitive, and -m1000 makes it much more slow and sensitive.
If you have ~50 GB of memory and don't mind waiting a few days, this is a good way to compare such genomes:
lastdb -cR11 -uMAM8 catdb cat.fa lastal -m100 -E0.05 catdb rat.fa | last-split -m1 > out.maf
This looks for a unique best alignment for each part of each rat chromosome. Omitting -m100 makes it faster but somewhat less sensitive. Omitting -uMAM8 reduces the memory use to ~10 GB and makes it faster but considerably less sensitive.
This recipe aligns each rat base-pair to at most one cat base-pair, but not necessarily vice-versa. You can get strictly 1-to-1 alignments by swapping the sequences and running last-split again:
maf-swap out.maf | last-split -m1 > out2.maf
For strongly similar genomes (e.g. 99% identity), something like this is more appropriate:
lastdb -cR11 -m1111110 human human.fa lastal -q3 -E0.05 -m50 human chimp.fa | last-split -m1 > out.maf
If you have more than one query sequence, you can go faster by aligning them in parallel. This can be done with parallel-fasta and parallel-fastq (which accompany LAST, but require GNU parallel to be installed: http://www.gnu.org/software/parallel/). These commands read sequence data, split it into blocks (with a whole number of sequences per block), and run the blocks in parallel through any command or pipeline you specify, using all your CPU cores. Here are some examples.
Instead of this:
lastal mydb queries.fa > myalns.maf
try this:
parallel-fasta "lastal mydb" < queries.fa > myalns.maf
Instead of this:
lastal -Q1 -e120 db q.fastq | last-split > out.maf
try this:
parallel-fastq "lastal -Q1 -e120 db | last-split" < q.fastq > out.maf
Instead of this:
zcat queries.fa.gz | lastal mydb > myalns.maf
try this:
zcat queries.fa.gz | parallel-fasta "lastal mydb" > myalns.maf
Notes:
Consider this alignment:
TGAAGTTAAAGGTATATGAATTCCAATTCTTAACCCCCCTATTAAACGAATATCTTG |||||||| |||||| | || | | | || |||||| ||||||||||| TGAAGTTAGAGGTAT--GGTTTTGAGTAGT----CCTCCTATTTTTCGAATATCTTG
The middle section has such weak similarity that its precise alignment cannot be confidently inferred.
It is sometimes useful to estimate the ambiguity of each column in an alignment. We can do that using lastal option -j4:
lastdb -cR01 humdb humanMito.fa lastal -j4 humdb fuguMito.fa > myalns.maf
The output looks like this:
a score=17 EG2=9.3e+09 E=5e-06 s seqX 0 57 + 57 TGAAGTTAAAGGTATATGAATTCCAATTCTTAACCCCCCTATTAAACGAATATCTTG s seqY 0 51 + 51 TGAAGTTAGAGGTAT--GGTTTTGAGTAGT----CCTCCTATTTTTCGAATATCTTG p %*.14442011.(%##"%$$$$###""!!!""""&'(*,340.,,.~~~~~~~~~~~
The "p" line indicates the probability that each column is wrongly aligned, using a compact code (the same as fastq-sanger format):
Symbol Error probability Symbol Error probability ! 0.79 -- 1 0 0.025 -- 0.032 " 0.63 -- 0.79 1 0.02 -- 0.025 # 0.5 -- 0.63 2 0.016 -- 0.02 $ 0.4 -- 0.5 3 0.013 -- 0.016 % 0.32 -- 0.4 4 0.01 -- 0.013 & 0.25 -- 0.32 5 0.0079 -- 0.01 ' 0.2 -- 0.25 6 0.0063 -- 0.0079 ( 0.16 -- 0.2 7 0.005 -- 0.0063 ) 0.13 -- 0.16 8 0.004 -- 0.005 * 0.1 -- 0.13 9 0.0032 -- 0.004 + 0.079 -- 0.1 : 0.0025 -- 0.0032 , 0.063 -- 0.079 ; 0.002 -- 0.0025 - 0.05 -- 0.063 < 0.0016 -- 0.002 . 0.04 -- 0.05 = 0.0013 -- 0.0016 / 0.032 -- 0.04 > 0.001 -- 0.0013
Note that each alignment is grown from a "core" region, and the ambiguity estimates assume that the core is correctly aligned. The core is indicated by "~" symbols, and it contains exact matches only.
LAST has options to find alignments with optimal column probabilities, instead of optimal score: see lastal.txt.